Basic Statistics
Measure | Value |
---|---|
Filename | cond2rep2_S5_L001_R1_001.fastq.bz2 |
File type | Conventional base calls |
Encoding | Sanger / Illumina 1.9 |
Total Sequences | 1841075 |
Sequences flagged as poor quality | 0 |
Sequence length | 75 |
%GC | 48 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
Sequence | Count | Percentage | Possible Source |
---|---|---|---|
TATATTAATTTCATCTGAAGACGTCCTCCACTCATGAGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATCCC | 5098 | 0.2769034395665576 | Search with Blastn,more detail First hit on +100: Mus musculus mitochondrial DNA from Lewis lung carcinoma, complete sequence Evalue=3.3219e-33, Ident=100%, QueryCovergap=0% |
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAG | 3191 | 0.17332265116847492 | TruSeq Adapter, Index 5 (100% over 63bp) |
TGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTC | 2557 | 0.13888624852328124 | Search with Blastn,more detail First hit on +100: PREDICTED: Cavia porcellus collagen alpha-1(I) chain-like (LOC100717127), mRNA Evalue=3.3219e-33, Ident=100%, QueryCovergap=0% |
Adapter Content
Kmer Content
Sequence | Count | PValue | Obs/Exp Max | Max Obs/Exp Position |
---|---|---|---|---|
CGTAT | 3490 | 0.0 | 8.239195 | 45 |
CGTCC | 6135 | 0.0 | 8.101 | 22 |
TCGTA | 3800 | 0.0 | 7.660471 | 44 |
GGTCG | 4030 | 0.0 | 7.0470953 | 14 |
CTAGG | 7135 | 0.0 | 7.015366 | 50 |
CGAAC | 4280 | 0.0 | 6.5525227 | 50 |
GCGAA | 4205 | 0.0 | 6.5005474 | 37 |
AATCG | 4230 | 0.0 | 6.4621277 | 47 |
TCGGT | 4285 | 0.0 | 6.4620304 | 12 |
CCTAG | 8615 | 0.0 | 6.387069 | 49 |
GTCGT | 4515 | 0.0 | 6.290098 | 15 |
GTCCG | 4255 | 0.0 | 6.2572985 | 18 |
TATAT | 11010 | 0.0 | 6.193719 | 1 |
GCCGT | 5115 | 0.0 | 6.176886 | 50 |
CGGTC | 4670 | 0.0 | 6.157343 | 13 |
GACGT | 7865 | 0.0 | 6.0482717 | 20 |
CCCTA | 9805 | 0.0 | 5.9739494 | 48 |
TCGAA | 5055 | 0.0 | 5.758613 | 49 |
ATATT | 11920 | 0.0 | 5.7182345 | 2 |
TCGTC | 5755 | 0.0 | 5.613339 | 16 |
Bad tiles
No bad tiles